| Featured Catalog |
 Order your free reference guide |
|
 |
| BioSupplyNet Featured Protocol exclusively sponsored by: |
| |
 |
Products for this protocol
|
|
| "Accelerating Customers' success through Leadership in Life Science, High Technology and Service" |
| |
| Genotyping by Oligonucleotide Ligation Assay (OLA) |
| |
Stuart J. Macdonald
Department of Ecology and Evolutionary Biology, University of Kansas, Lawrence, Kansas 66045, USA
Department of Molecular Biosciences, University of Kansas, Lawrence, Kansas 66045, USA
Corresponding author (sjmac@ku.edu)
This protocol was adapted from Genetic Variation: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, 2007.
|

Buy The Book
|

See More Protocols
|
| |
| INTRODUCTION |
This protocol describes the oligonucleotide ligation assay (OLA), which uses a set of three oligonucleotides, in combination with a thermostable Taq DNA ligase enzyme, to discriminate single-nucleotide polymorphism (SNP) alleles. Sixteen-plex OLA genotyping reactions are carried out, and allele-specific OLA products are detected on membrane arrays using radiolabeled probes.
|
MATERIALS
|
Reagents
|
- Adenosine 5'-triphosphate (ATP) solution (100 mM)
- Amplification buffer (10X) (500 mM KCl containing 1% Triton X-100)
A minimal amplification buffer is used because the amplification reagents are added directly to the OLA reaction, which already contains appropriate Tris-Cl and MgCl2 concentrations for PCR.
- [{gamma}-33P]ATP (250 µCi)
- Denaturation solution
- 0.5 M NaOH
- 1.5 M NaCl
For neutral transfer, double-stranded DNA targets only.
- dNTPs (25 mM)
- DTT (25 mM)
- Herring sperm DNA, sonicated (10 µg/µL)
- OLA buffer, 10X
- Tris-Cl (500 mM, pH 8.5)
- KCl (500 mM)
- MgCl2 (75 mM)
- ß-NAD (10 mM)
- Oligonucleotides (also see Step 1 and Table 1):
- M13F.BRL (50 µM): CCCAGTCACGACGTTGTAAAACG
- M13R.BRL (50 µM): AGCGGATAACAATTTCACACAGG
- OLA hybridization buffer (prewarmed to 42ºC)
- 0.525 M sodium phosphate (pH 7.2)
- 7% SDS
- 1 mM EDTA (pH 8.0)
- 10 mg/ml bovine serum albumin (BSA)
Make fresh prior to each hybridization and filter-sterilize to remove any impurities that may bind to nylon membranes.
- OLA neutralization buffer
- Tris-Cl (0.4 M, pH 7.4)
- SSC (2X)
- OLA washing buffer, prewarmed to 40°C
- PCR-amplified DNA samples containing the SNPs of interest
- Stripping buffer (0.1% SDS), preheated to 80°C
- T4 polynucleotide kinase (10 U/µL) and 10X buffer
- Taq DNA ligase (40 U/µL)
- Taq DNA polymerase (5 U/µL)
Because the amplified products are very small, almost any thermostable DNA polymerase can be used.
|
Equipment
|
- Arrayer for nylon membranes (custom built)
See http://cstern.bio.uci.edu/tools/genotyping.htm for information about custom-built arrayers for nylon membranes.
- Centrifuge with adaptors for microtiter plates
- Equipment for running diagnostic gel (see Step 12)
- Heating blocks at 37°C, 65°C, 80°C, 96°C
- Hybridization oven preset to 42°C
- Hybridization tubes
- Image acquisition software package (e.g., GE Healthcare ArrayVision)
- Laboratory gloves (powder-free)
- Liquid-handling system (e.g., Art Robbins Instruments Hydra) (optional; see Step 7)
- Manual pin-tool (optional; see Steps 8 and 15)
- PCR plates (96-well or 384-well)
- PCR thermocyclers (e.g., Applied Biosystems dual-block 384-well 9700)
- Phosphor imager (e.g., GE Healthcare Typhoon)
- Radioactive waste container
- Repeater pipette (optional; see Step 7)
- Shaking platform
- Software for genotype analysis
The free statistical programming package R is available at http://www.r-project.org/ . Custom genotype-calling software for R is available at http://cstern.bio.uci.edu/tools/genotyping.htm.
- Storage phosphor screens (e.g. GE Healthcare 63-0034-82)
- Ultraviolet (UV) cross-linker (50 mJ)
- Water baths at 40°C, 80°C
|
METHOD
|
An overview of the genotyping pipeline is given in Figure 1 .

Figure 1. The OLA genotyping pipeline.
Generation of OLA Genotyping Oligonucleotides
- For each SNP of interest, design two upstream allele-specific oligonucleotides (47 nucleotides [nt]) and a single common downstream oligonucleotide (31 nt) as follows:
- Upstream_a: M13F + C + Barcode_a + Up_flank + Allele_a
- Upstream_b: M13F + C + Barcode_b + Up_flank + Allele_b
- Downstream: Down_flank + G + M13R.RC
Sections of the OLA genotyping oligonucleotides are:
- M13F: GACGTTGTAAAACG
- M13R.RC: CCTGTGTGAAATTG
- A "C" or "G" nucleotide adjacent to the M13 sequence ensures that multiple ligated products of different sequence are evenly amplified.
- Barcode_a" and "Barcode_b": These are the 16-nt bar code sequences permitting allele discrimination during hybridization shown in Table 1. Sixteen pairs are available, permitting 16-plex OLA reactions--one pair of bar codes/probes per SNP in the reaction.
- "Up_flank" and "Down_flank": These are 15 nt and 16 nt, respectively, and specific to the region upstream and downstream of the target SNP, respectively. If either of these flanking regions segregates for an additional SNP, the oligonucleotide sequence at those sites can incorporate a degenerate base.
- "Allele_a" and "Allele_b": These represent the allele at the target SNP.
- Synthesize the unmodified genotyping nucleotides (from Step 1) at the lowest synthesis scale, and dilute each of them to a concentration of 100 µM.
- Create a 1-µM 16-plex upstream OLA oligonucleotide mix by mixing 2 µL of each of the 32 upstream oligonucleotides (at 100 µM) with 136 µL of H2O.
-
Independently 5'-phosphorylate the downstream oligonucleotides.
- For each 12.5-µL reaction, use:
| H2O |
8.125 µL |
| T4 polynucleotide kinase buffer (10X) |
1.25 µL |
| ATP (100 mM) |
0.125 µL |
| T4 polynucleotide kinase (10 U/µL) |
1 µL |
| Downstream oligonucleotide (100 µM) |
2 µL |
- Incubate these reactions for 1 h at 37°C.
- Stop the reactions by incubating for 20 min at 65°C.
Phosphorylation is required so that up- and downstream oligonucleotides can be ligated, and should not be performed en masse (interactions among oligonucleotides can prevent equal phosphorylation of each oligonucleotide).
- Create a 1-µM 16-plex downstream OLA oligonucleotide mix by mixing together 12 µL of each of the 16 downstream oligonucleotide phosphorylation reactions.
OLA Reaction
-
Make up the following reagent mix (3 µL/reaction) for a sufficient number of samples:
| H2O |
2.3 µL |
| OLA buffer (10X) |
0.3 µL |
| DTT (25 mM) |
0.3 µL |
| Taq DNA ligase (40 U/µL) |
0.04 µL |
| Upstream oligonucleotide mix (from Step 3) |
0.03 µL |
| Downstream oligonucleotide mix (from Step 5) |
0.03 µL |
- Add 3 µL of the reagent mix to each well of a 384- or 96-well PCR plate, using a repeater pipette or a liquid-handling robot.
- Use a liquid-handling robot or a manual pin-tool to spike the reactions with 0.2 µL of PCR-amplified DNA containing the SNPs of interest.
Consistency among samples is reduced with a pin-tool.
Some of the PCR samples should be no-DNA PCR blanks as controls.
-
Seal the plate(s) and centrifuge briefly. Perform ligation using the following cycling profile:
|
Number of cycles | Denaturation | Ligation |
1 | 5 min at 95°C | |
3 | 30 sec at 95°C | 25 min at 45°C |
OLA Amplification Reaction
- Make up the following reagent mix (12 µL/reaction) for a sufficient number of samples:
| H2O | 10.196 µL |
| Amplification buffer (10X) | 1.2 µL |
| dNTPs (25 mM) | 0.024 µL |
| Taq DNA polymerase (5 U/µL) | 0.1 µL |
| M13F.BRL (50 µM) | 0.24 µL |
| M13R.BRL (50 µM) | 0.24 µL |
- Add 12 µL of reagent mix directly to each OLA ligation reaction (from Step 9), seal the plate(s), and centrifuge briefly. Amplify the ligation products using the following cycling profile:
| Number of cycles | Denaturation | Annealing | Extension |
| 1 | 2 min at 94°C | | |
| 32 | 25 sec at 94°C | 35 sec at 58°C | 35 sec at 72°C |
| 1 | 2 min at 72°C | | |
- Run both control (no-DNA PCR) and positive samples on a diagnostic gel: A bright band (78 bp) should be visible in the positive samples, and not in the blank controls.
Because the concentration of M13 primer in the OLA amplification reactions is very high, blanks normally contain an accessory "primer-dimer" band that is smaller than the positive band.
Arraying
- Dry down the OLA amplification reactions at 65°C in a thermocycler for ~1 h.
- Add 5 µL of denaturation solution to each well, and resuspend/denature the samples in the thermocycler using this profile:
| Step |
Resuspension |
Denaturation |
| 1 |
15 min at 65°C |
|
| 2 | | 5 min at 95°C |
- Print samples onto nylon membranes using an arraying robot. Wear powder-free laboratory gloves, and do not touch membranes with bare hands. Allow the membrane spots to dry for 10 min.
A manual pin-tool can be used to print samples, although spot quality suffers.
- UV-cross-link the samples at 50 mJ, and gently shake the membranes in a bath of neutralization buffer for 30 min (to neutralize the high pH of the denaturing print solution).
Hybridization
- Add membrane(s) to the hybridization tube (multiple membranes can be stacked in a single tube). Add 5 mL of prewarmed (42°C) hybridization buffer and 50 µL of sonicated herring sperm DNA that has been denatured by incubation for 5 min at 96°C.
- Rotate the tube in a hybridization oven at 4 rpm overnight (for the first use of the membranes) or for 3 h (for all subsequent hybridizations) at 42°C.
- Prepare a radiolabeled oligonucleotide probe.
- End-label the oligonucleotide (see Table 1) with [{gamma}-33P]ATP in the following 10-µL reaction:
| H2O | 5 µL |
| T4 polynucleotide kinase buffer (10X) | 1 µL |
| Probe oligonucleotide (10 µM) | 1 µL |
| T4 polynucleotide kinase (10 U/µL) | 1 µL |
| [{gamma}-33P]ATP (10 µCi/µL) | 2 µL |
- Incubate this reaction for 40 min at 37°C.
- Stop the reaction by incubating it for 15 min at 80°C.
It is not necessary to column- (or otherwise) purify this reaction before use.
- Add the radiolabeled probe reaction to the hybridization tube, and rotate the tube in a hybridization oven at 4 rpm for 4 h at 42°C.
- Empty the hybridization buffer/radiolabeled probe to waste. Briefly rinse the tube with a small quantity of washing buffer (prewarmed to 40°C), and also discard this to waste.
- Add 50 mL of prewarmed (40°C) washing buffer. Rotate the tube at 4 rpm for 20 min at 40°C, and discard the buffer to waste. Perform three to five of these wash cycles.
The number of wash cycles required will depend on the number of filters hybridized per tube. Too few wash cycles will lead to an inconsistent background level of radiation across the membrane surface.
- Remove the membranes from the hybridization tube and rinse in a bath of prewarmed washing buffer at 40°C.
Data Collection
- Expose the hybridized/washed membranes to a phosphor screen for 3-4 d. Scan the screen using a phosphor imager.
The actual exposure time required will depend on the spot intensity of the hybridized membranes.
- Analyze the images with an image acquisition software package (e.g., GE Healthcare ArrayVision). Call genotypes using custom software (http://cstern.bio.uci.edu/tools/genotyping.htm) available for the free statistical programming package R (http://www.r-project.org/).
Stripping
Once membranes have been imaged, they must be stripped prior to being reprobed.
- Move membranes from the phosphor screen cassette to a bath of neutralization buffer to ensure that they stay moist.
If membranes dry out while radiolabeled probe is bound, the probe can become permanently fixed to the membranes.
- Add the membranes to hybridization tubes with 50 mL of stripping buffer preheated to 80°C. Rotate the tubes at 4 rpm for 15 min at 80°C.
- Discard the buffer to waste, and either store the membranes at 4°C in neutralization buffer, or start the protocol again from Step 17.
Table 1. Probes and bar codes
| Probe number | Probe/bar code a | Probe/bar code b |
| 01 | ATATTCTGAGACACGCCGCG | ATACGCGATGGGATCAGACT |
| 02 | ATGCGACTCTTGACGAACGT | TTCGAGCGTCTGGCACACTT |
| 03 | GTCACTCGTGTCCAGGATGT | TATCGCGTGTCAGTGCTTGT |
| 04 | GATACCGGACCATGTTTCGC | GATGTTCGTCCATGCGACCT |
| 05 | TGATCCGCGTCGATGCTCTT | GCAGTCACGTTCTCGAATCG |
| 06 | TTTAGCCGGATCACCGTGTG | ATATGTGCAGAACCCGCGAC |
| 07 | AGAGAGACGTTGCCCAAGTC | GATGCGATACCCTGCGATCT |
| 08 | ATTTAGCGTGCAGCCGACCT | ATGCGTGGTGTCCGATCATA |
| 09 | TAAGGGTTACGAACATCGCC | TGGACTCTCATAACGGCGTC |
| 10 | GCAGCTCGTCACAGGTATTG | TACCGGATTACAGCTCGTGG |
| 11 | AGCTAATGTCGAGTCACGCT | TCTACACGAGAACGAGGCAC |
| 12 | AGCGCGACGTTGATCCAGAT | AATGAACGAGACCGCGTGAC |
| 13 | TCGGACTCGTGACGCTATTT | ATGAGAGTTCGATGACCTGT |
| 14 | ACGCACTGACGATCATTCGG | TTCGACCCGGACGACTGTAT |
| 15 | TATAGCCGTGAACCCGATGC | TAAAGCACAGTCCGTAATCT |
| 16 | ATCATGTCCCAAGCGCGGTA | AAGCCGATGTCGATCTACCT |
All 20-nt probe sequences are given in the 5' to 3' direction. The 16-nt bar code sequences incorporated into the upstream OLA oligonucleotides (see Step 1) are the reverse complement of the underlined portion.
|
Anyone using the procedures in this protocol does so at their own risk. Cold Spring Harbor Laboratory makes no representations or warranties with respect to the material set forth in this protocol and has no liability in connection with the use of these materials. Materials used in this protocol may be considered hazardous and should be used with caution. For a full listing of cautions regarding these material, please consult:
Genetic Variation: A Laboratory Manual, edited by Michael P. Weiner, Stacey B. Gabriel and J. Claiborne Stevens, © 2007 by Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
|
| |
| Copyright © 2007 by Cold Spring Harbor Laboratory Press. All rights reserved.
No part of these pages, either text or image may be used for any purpose other than personal use. Therefore, reproduction modification, storage in a retrieval system or retransmission, in any form or by any means, electronic, mechanical, or otherwise, for reasons other than personal use, is strictly prohibited without prior written permission.
|
|